Quick Order

Text Size:AAA

Human PPIL2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PPIL2cDNA Clone Product Information
cDNA Size:1584
cDNA Description:ORF Clone of Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 2 DNA.
Gene Synonym:CYC4, CYP60, Cyp-60, FLJ39930, MGC33174, MGC787, hCyP-60, PPIL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PPIL2, is an enzyme which belongs to the cyclophilin family. The cyclophilins are peptidylprolyl isomerases and are highly conserved ubiquitous. They play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL2 interacts with the proteinase inhibitor eglin c and is localized in the nucleus. It contains 1 PPIL2 cyclophilin-type domain and 1 U-box domain. PPIL2 accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.

  • Grouse LH. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Payan DG. et al., 1996, Biochem J. 314 (1): 313-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items