Quick Order

Text Size:AAA

Human SUSD4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SUSD4cDNA Clone Product Information
Gene_bank_ref_id:BC004888
cDNA Size:873
cDNA Description:ORF Clone of Homo sapiens sushi domain containing 4 DNA.
Gene Synonym:PRO222, RP11-239E10.4, SUSD4
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

SUSD4, also known as sushi domain-containing protein 4, is a hypothetical cell surface protein whose tissue distribution and function are completely unknown. SUSD4 is detectable in murine brains, eyes, spinal cords, and testis but not other tissues. In brains, SUSD4 is highly expressed in the white matter on oligodendrocytes/axons, and in eyes, it is exclusively expressed on the photoreceptor outer segments. In in vitro complement assays, SUSD4 augments the alternative but not the classical pathway of complement activation at the C3 convertase step. SUSD4 deficiency may cause autism or Fryns syndrome, both of which are genetic diseases with severe abnormal neurological development and/or functions.

References
  • Kimura K. et al., 2006, Genome Res. 16 (1): 55-65.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Tu Z. et al., 2010, Am J Pathol. 176 (5): 2378-84.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"