Quick Order

Human CKB ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CKB cDNA Clone Product Information
Gene_bank_ref_id:BC001190
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Homo sapiens creatine kinase, brain with C terminal His tag.
Gene Synonym:B-CK, CKBB, CKB
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

References
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Catalog: HG14415-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"