Quick Order

Human IDS / MPS2 transcript variant 1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IDS cDNA Clone Product Information
Gene_bank_ref_id:NM_000202.5
RefSeq ORF Size:1653bp
cDNA Description:Full length Clone DNA of Homo sapiens iduronate 2-sulfatase, transcript variant 1 with N terminal HA tag.
Gene Synonym:MPS2, SIDS
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Catalog: HG10337-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"