After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD50 / ICAM3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICAM3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002162.3
RefSeq ORF Size:1644bp
cDNA Description:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 3 with N terminal HA tag.
Gene Synonym:CD50, CDW50, ICAM-R
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

References
  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.
  • Size / Price
    Catalog: HG10333-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"