Quick Order

Human C10ORF54 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human C10ORF54 cDNA Clone Product Information
Gene_bank_ref_id:BC020568
RefSeq ORF Size:936bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 10 open reading frame 54 with N terminal His tag.
Gene Synonym:GI24, B7-H5, SISP1, PP2135, C10orf54
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

C10orf54, also known as GI24, belongs to the immunoglobulin superfamily. It is a transmembrane molecule expressed in bone, on embryonic stem cells (ESCs), and on tumor cell surfaces. On ESCs, C10orf54 appears to positively interact with BMP-4, potentiating BMP signaling and the transition from an undifferentiated to a differentiated state. On tumor cells, C10orf54 both promotes MT1-MMP expression and activity and serves as a substrate for MT1-MMP. This increases the potential for cell motility. Human C10orf54 undergoes proteolytic cleavage by MT1-MMP, generating a soluble 30 kDa extracellular fragment plus a 25-30 kDa membrane-bound fragment.

References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • Colland F, et al. (2004) Functional proteomics mapping of a human signaling pathway. Genome Res. 14(7):1324-32.
  • Size / Price
    Catalog: HG13482-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"