After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ST6GAL1 transcript variant 2 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human ST6GAL1 cDNA Clone Product Information
NCBI RefSeq:NM_003032.2
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens ST6 beta-galactosamide alpha-2,6-sialyltranferase 1, transcript variant 2 with C terminal HA tag.
Gene Synonym:ST6GAL1
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-ST6GAL1-HA
Restriction Site:HindIII + XbaI (6kb + 1.26kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ST6GAL1 Gene Plasmid Map
Human ST6GAL1 transcript variant 2 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

References
  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    Catalog: HG11590-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"