After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MMP-9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMP9cDNA Clone Product Information
cDNA Size:2157
cDNA Description:ORF Clone of Homo sapiens matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V collagenase) DNA.
Gene Synonym:GELB, CLG4B, MMP-9
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2082 G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 Business days
    • Human MMP-9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged
    Recently Viewed Items