Quick Order

Text Size:AAA

Human LCN1 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human LCN1 cDNA Clone Product Information
NCBI RefSeq:NM_002297.2
RefSeq ORF Size:531bp
cDNA Description:Full length Clone DNA of Homo sapiens lipocalin 1 (tear prealbumin) with C terminal HA tag.
Gene Synonym:TP, PMFA, VEGP, MGC71975, LCN1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Lipocalin-1, also known as Von Ebner gland protein, VEG protein, Tear prealbumin, VEGP, Tear lipocalin and LCN1, is a secreted protein which belongs to the calycin superfamily and Lipocalin family. Human Lipocalin-1 / VEGP was originally described as a major protein of human tear fluid, which was thought to be tear specific. Lipocalin-1 / VEGP is identical with lingual von Ebner's gland protein, and is also produced in prostate, nasal mucosa and tracheal mucosa. Homologous proteins have been found in rat, pig and probably dog and horse. Lipocalin-1 / VEGP is an unusual lipocalin member, because of its high promiscuity for relative insoluble lipids and binding characteristics that differ from other members. Lipocalin-1 / VEGP acts as the principal lipid binding protein in tear fluid, a more general physiological function has to be proposed due to its wide distribution and properties. Lipocalin-1 / VEGP would be ideally suited for scavenging of lipophilic, potentially harmful substances and thus might act as a general protection factor of epithelia. Lipocalin-1 / LCN1 could play a role in taste reception. It could be necessary for the concentration and delivery of sapid molecules in the gustatory system. Lipocalin-1 / LCN1 can bind various ligands, with chemical structures ranging from lipids and retinoids to the macrocyclic antibiotic rifampicin and even to microbial siderophores. It exhibits an extremely wide ligand pocket.

References
  • Lassagne H. et al., 1993, Exp. Eye Res. 56:605-609.
  • Redl,B. et al., 2000, Biochim Biophys Acta  1482 (1-2):241-8.
  • Wojnar P. et al., 2001, J. Biol. Chem. 276:20206-20212.
  • Wojnar P. et al., 2003, J. Biol. Chem. 278:16209-16215.
  • Breustedt D.A. et al., 2005, J. Biol. Chem. 280:484-493.
  • Size / Price
    Catalog: HG11583-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"