Quick Order

Text Size:AAA

Human PLEK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLEKcDNA Clone Product Information
cDNA Size:1053
cDNA Description:ORF Clone of Homo sapiens pleckstrin DNA.
Gene Synonym:P47, PLEK
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Pleckstrin is a protein found in platelets. Pleckstrin is the source of the name pleckstrin homology domain. Pleckstrin homology domain (PH domain) is a protein domain of approximately 120 amino acids that occurs in a wide range of proteins involved in intracellular signaling or as constituents of the cytoskeleton. This domain can bind Phosphatidylinositol lipids within biological membranes (such as Phosphatidylinositol (3,4,5)-trisphosphate and phosphatidylinositol (4,5)-bisphosphate), and proteins such as the βγ-subunits of heterotrimeric G proteins, and protein kinase C. Through these interactions, PH domains play a role in recruiting proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways.

  • Ingley E, et al. (1994) Pleckstrin homology (PH) domains in signal transduction. J Cell Biochem. 56(4):436-43.
  • Gibson TJ, et al. (1994) PH domain: the first anniversary. Trends Biochem Sci. 19(9):349-53.
  • Haslam RJ, et al. (1993) Pleckstrin domain homology. Nature. 363(6427):309-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks