After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RNASE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RNASE1cDNA Clone Product Information
cDNA Size:471
cDNA Description:ORF Clone of Homo sapiens ribonuclease, RNase A family, 1 (pancreatic) DNA.
Gene Synonym:RIB1, RNS1, RNASE1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

RNase A, also known as ribonuclease A and RNASE1, belongs to ribonuclease A superfamily. It is a pancreatic-type of secretory ribonuclease. RNase A is a basic protein and its many positive charges are consistent with its binding to RNA (a poly-anion). More generally, RNase A is unusually polar or, rather, unusually lacking in hydrophobic groups, especially aliphatic ones. As a endonuclease, RNase A cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. RNase A is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified.

  • Tubert P, et al. (2011) Interactions crucial for three-dimensional domain swapping in the HP-RNase variant PM8. Biophys J. 101(2):459-67.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Fischer S, et al. (2011) Expression and localisation of vascular ribonucleases in endothelial cells. Thromb Haemost. 105(2):345-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items