Quick Order

Text Size:AAA

Human CST1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001898.2
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin SN with C terminal HA tag.
Gene Synonym:CST1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Cystatin-SN, also known as Cystain-SA-I, Cystatin-1, Salivary cystatin-SA-1 and CST1, is a secreted protein which belongs to the cystatin family. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. Cystatin-SN / CST1 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). Cystatin-SN / CST1 is also expressed in saliva, tears, urine and seminal fluid. Human saliva appears to contain several cysteine proteinase inhibitors that are immunologically related to cystatin S but that differ in their specificity due to amino acid sequence differences. Human salivary cystatins include Cystatin-S, Cystatin-S1, Cystatin-S2, Cystatin- SA, Cystatin-SN, Cystatin-C and Cystatin-D. Cystatin-SN is a much better inhibitor of papain and dipeptidyl peptidase I than is cystatin-S, although both inhibit ficin equally well.

Size / Price
Catalog: HG11568-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"