After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NETO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NETO1cDNA Clone Product Information
cDNA Size:1602
cDNA Description:ORF Clone of Homo sapiens neuropilin (NRP) and tolloid (TLL)-like 1 DNA.
Gene Synonym:BCTL1, BTCL1, NETO1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

  • Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.
  • Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.
  • Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items