After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PTPN12 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPN12 cDNA Clone Product Information
Gene_bank_ref_id:NM_002835.3
RefSeq ORF Size:2343bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 12 with C terminal HA tag.
Gene Synonym:PTPG1, PTP-PEST, PTPN12
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PTPN12 is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTPN12 contains a C-terminal PEST motif, which serves as a protein–protein interaction domain, and may be related to protein intracellular half-life. PTPN12 was found to bind and dephosphorylate the product of oncogene c-ABL, thus may play a role in oncogenesis. PTPN12 was shown to interact with, and dephosphorylate, various of cytoskeleton and cell adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin, which suggested its regulatory roles in controlling cell shape and mobilit.

References
  • Garton AJ. et al., 1997, Oncogene. 15 (8): 877-85.
  • Lin Yi. et al., 2003, Am J Physiol Heart Circ. 285 (2): H710-21.
  • Takekawa M. et al., 1994, FEBS Lett. 339 (3): 222-8.
  • Size / Price
    Catalog: HG11556-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"