Quick Order

Text Size:AAA

Human VRK1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VRK1 cDNA Clone Product Information
NCBI RefSeq:NM_003384.2
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Homo sapiens vaccinia related kinase 1 with C terminal HA tag.
Gene Synonym:PCH1, MGC117401, MGC138280, MGC142070, VRK1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

VRK1 is a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. Serine/threonine protein kinases are tumor suppressor that controls the activity of AMP-activated protein kinase family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. VRK1 contains 1 protein kinase domain and localizes to the nucleus. VRK1 gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. As a serine/threonine kinase, VRK1 phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Defects in VRK1 are the cause of pontocerebellar hypoplasia type 1 (PCH1), also called pontocerebellar hypoplasia with infantile spinal muscular atrophy or pontocerebellar hypoplasia with anterior horn cell disease. PCH1 is characterized by an abnormally small cerebellum and brainstem, central and peripheral motor dysfunction from birth, gliosis and anterior horn cell degeneration resembling infantile spinal muscular atrophy.

References
  • Sugimoto J, et al. (1999) Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus. J Hum Genet. 44 (2): 133-4.
  • Lopez-Borges S, et al. (2000) The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Oncogene. 19 (32): 3656-64.
  • Sevilla A, et al. (2004) c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Oncogene. 23 (55): 8950-8.
  • Size / Price
    Catalog: HG11555-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"