After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
POSTNcDNA Clone Product Information
cDNA Size:2256
cDNA Description:ORF Clone of Homo sapiens periostin, osteoblast specific factor, transcript variant 4 DNA.
Gene Synonym:Pn, OSF-2, PDLPOSTN, MGC119510, MGC119511, periostin, RP11-412K4.1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10299-ACG$345
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10299-ACR$345
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10299-CF$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10299-CH$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10299-CM$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10299-CY$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10299-G$195
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10299-G-F$445
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10299-G-N$445
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10299-NF$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10299-NH$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10299-NM$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10299-NY$315
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10299-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks