Quick Order

Text Size:AAA

Human GADD45G Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GADD45GcDNA Clone Product Information
cDNA Size:480
cDNA Description:ORF Clone of Homo sapiens growth arrest and DNA-damage-inducible, gamma DNA.
Gene Synonym:RP11-260L6.1, CR6, DDIT2, GADD45gamma, GRP17, GADD45G
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human GADD45G Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are raised after stressful growth arrest conditions and treatment with DNA-damaging agents. GADD45G reacts to environmental stresses by mediating activation of the p38/JNK pathway which is mediated through their protein binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. GADD45G acts as a new-age tumor suppressor however is being frequently inactivated epigenetically in multiple tumors. GADD45G mRNA expression is down-regulated in hepatocellular carcinoma. GADD45G causes cell cycle arrest at G2/M transition when transfected into Hep-G2 cells. GADD45G induction by androgens involves new protein synthesis. Overexpression of GADD45G inhibits cell growth and causes morphological modifications in prostate cell lines thus GADD45G takes part in differentiation induction by androgens.

  • Takekawa M. et al., 1998, Cell. 95 (4): 521-30.
  • Suzuki M. et al., 1999, J Hum Genet. 44 (5): 300-3.
  • Azam N. et al., 2001, J Biol Chem. 276 (4): 2766-74.