Quick Order

Mouse PDHA1 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse PDHA1 cDNA Clone Product Information
NCBI RefSeq:NM_008810.2
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Mus musculus pyruvate dehydrogenase E1 alpha 1 with C terminal Myc tag.
Gene Synonym:Pdha-1
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PDHA1, also known as C54G1, is an alpha subunit of pyruvate dehydrogenase. Pyruvate dehydrogenase, together with dihydrolipoamide acetyltransferase and lipoamide dehydrogenase, composes the pyruvate dehydrogenase (PDH) complex. The PDH complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. PDHA1 plays a key role in the function of the PDH complex. Defects in PDHA1 can cause pyruvate dehydrogenase E1-alpha deficiency. Defects in PDHA1 also are the cause of X-linked Leigh syndrome (X-LS). X-LS is an early-onset progressive neurodegenerative disorder with a characteristic neuropathology consisting of focal, bilateral lesions in one or more areas of the central nervous system, including the brainstem, thalamus, basal ganglia, cerebellum, and spinal cord.

References
  • Quintana E. et al., 2010, Clin Genet. 77 (5): 474-82.
  • Ah Mew N. et al., 2011, Pediatr Neurol. 45 (1): 57-9.
  • Pinheiro A. et al., 2012, Gene. 506 (1): 173-8.
  • Size / Price
    Catalog: MG51206-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"