After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PAK3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PAK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001128166.1
RefSeq ORF Size:1635bp
cDNA Description:Full length Clone DNA of Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 3 with C terminal HA tag.
Gene Synonym:bPAK, MRX30, MRX47, OPHN3, hPAK3, CDKN1A, PAK3beta, PAK3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PAK3 is a member of PAK proteins, a family of serine/threonine p21-activating kinases, serve as effectors of small Rho GTPases Cdc42 and RAC and have been implicated in a wide range of biological activities. There are six mammalian PAKs which can be divided into two groups: group I PAKs (PAK1-3) and group II PAKs (PAK4-6). Although the two PAK groups are architecturally similar there are differences in their mode of regulation suggesting their cellular functions are likely to be different. Group I p21-activated kinases (PAK1/2/3) is demonstrated as ERK3/ERK4 activation loop kinases. It has been shown that group I PAKs phosphorylate ERK3 and ERK4 on Ser-189 and Ser-186, respectively, both in vitro and in vivo, and that expression of activated Rac1 augments this response. Besides regulation enzymatic activation of ERK3/ERK4, PAKs can also play roles in downstream activation of MAP kinase-activated protein kinase 5 (MK5) in vivo. Thus, the  group I PAKs act as upstream activators of ERK3 and ERK4 and unravel a novel PAK-ERK3/ERK4-MK5 signaling pathway. In clinical, PAK has been proposed as a potential therapeutic target in schwannomas.

References
  • Whale A, et al. (2011) Signalling to cancer cell invasion through PAK family kinases. Front Biosci. 16: 849-64.
  • Deleris P, et al. (2011) Activation loop phosphorylation of ERK3/ERK4 by group I p21-activated kinases (PAKs) defines a novel PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway. J Biol Chem. 286 (8): 6470-8.
  • Canet B, et al. (2011) Ovarian clear cell carcinomas: RHO GTPases may contribute to explain their singular biologic behavior. Hum Pathol. 42 (6): 833-9.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"