Quick Order

Human METRN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
METRNcDNA Clone Product Information
cDNA Size:882
cDNA Description:ORF Clone of Homo sapiens meteorin, glial cell differentiation regulator DNA.
Gene Synonym:MGC2601, C16orf23, c380A1.2, METRN
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items