After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse SHH Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SHHcDNA Clone Product Information
cDNA Size:1314
cDNA Description:ORF Clone of Mus musculus sonic hedgehog DNA.
Gene Synonym:Hx, Dsh, Hhg1, Hxl3, M100081, 9530036O11Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.