Quick Order

Text Size:AAA

Human PFDN2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PFDN2 cDNA Clone Product Information
Gene_bank_ref_id:BC012464
RefSeq ORF Size:465bp
cDNA Description:Full length Clone DNA of Homo sapiens prefoldin subunit 2 with C terminal His tag.
Gene Synonym:HSPC231, PFD2, PFDN2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PFD2, also known as PFDN2, belongs to the prefoldin beta subunit family. PFD2 is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFD2 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFD2 also binds to a nascent polypeptide chain and promotes folding in an setting in which there are many competing pathways for nonnative proteins.

References
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Bauch A, et al. (2004) A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway. Nat Cell Biol. 6(2):97-105.
  • Nogaj LA, et al. (2005) Cellular levels of glutamyl-tRNA reductase and glutamate-1-semialdehyde aminotransferase do not control chlorophyll synthesis in Chlamydomonas reinhardtii. Plant Physiol. 139(1):389-96.
  • Size / Price
    Catalog: HG14349-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"