Quick Order

Text Size:AAA

Human ENPP5 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENPP5 cDNA Clone Product Information
NCBI RefSeq:NM_021572.4
RefSeq ORF Size:1434bp
cDNA Description:Full length Clone DNA of Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) with C terminal HA tag.
Gene Synonym:KIAA0879, ENPP5
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family(NPP). It is a family comprised by dimeric enzymes that catalyze the hydrolysis of phosphate diester bonds. There are seven isoforms in NPP family, some of which prefer nucleotide substrates, some of which prefer phospholipid substrates, and others of which prefer substrates that have not yet been determined. NPP also belongs to the alkaline phosphatase (AP) superfamily of enzymes and they are located in the cell membrane and hydrolyze extracellular phosphate diesters to affect a wide variety of biological processes. ENPP5 belongs to a group of nucleotidemetabolizing ectoenzymes, which regulate the availability of extracellular nucleotides. ENPP5 may play a role in neuronal cell communication. Hhowever, it lacks nucleotide pyrophosphatase and lysopholipase D activity. It may also be involved in neuronal cell communication. The amino acid sequence of human ENPP5 is 100%, 88%, and 82% identical to that of chimpanzee, dog and mouse/rat. ENPP5 functions in phospholipid metabolism.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Size / Price
    Catalog: HG11519-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"