Quick Order

Text Size:AAA

Human FSTL5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FSTL5cDNA Clone Product Information
Gene_bank_ref_id:NM_020116.3
cDNA Size:2544
cDNA Description:ORF Clone of Homo sapiens follistatin-like 5 DNA.
Gene Synonym:FSTL5
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular region). FSTL5 expression denoted a dismal prognosis both within and across medulloblastoma subgroups. FSTL5 gene is well expressed, 1.0 times the average gene in this release. The sequence of this gene is defined by 120 GenBank accessions from 113 cDNA clones, some from brain, cerebellum, eye, melanotic melanoma, skin, amygdala, breast and 24 other tissues. FSTL5 gene contains 27 distinct introns. The addition of FSTL5 immunohistochemistry to existing molecular stratification schemes constitutes a reliable and cost-effective tool for prognostication in future clinical trials of medulloblastoma.

References
  • Masuda T, et al. (2009) Laser capture microdissection and cDNA array analysis for identification of mouse KIAA/FLJ genes differentially expressed in the embryonic dorsal spinal cord. Brain Res. 1249:61-7.
  • Kingwell K. (2011) FSTL5--a new prognostic biomarker for medulloblastoma. Nat Rev Neurol. 7(11):598.
  • Remke M, et al. (2011) FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol. 29(29):3852-61.
  • Size / Price
    Catalog:HG13408-NH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"