After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MDK / NEGF2 transcript variant 2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MDK cDNA Clone Product Information
Gene_bank_ref_id:NM_001012333.1
RefSeq ORF Size:432bp
cDNA Description:Full length Clone DNA of Homo sapiens midkine (neurite growth-promoting factor 2), transcript variant 2 with N terminal HA tag.
Gene Synonym:MDK, MK, NEGF2, FLJ27379
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase, and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as breast carcinomas marker.

References
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Size / Price
    Catalog: HG10247-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"