After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTScDNA Clone Product Information
cDNA Size:438
cDNA Description:ORF Clone of Homo sapiens 6-pyruvoyltetrahydropterin synthase DNA.
Gene Synonym:FLJ97081, PTPS, PTS
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PTS(6-pyruvoyltetrahydropterin synthase) belongs to the PTPS family. It catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. PTS is involved in the biosynthesis of tetrahydrobiopterin, an essential cofactor of aromatic amino acid hydroxylases. PTS also catalyzes the transformation of 7,8-dihydroneopterin triphosphate into 6-pyruvoyl tetrahydropterin. Defects in PTS are the cause of BH4-deficient hyperphenylalaninemia type A (HPABH4A), also called 6-pyruvoyl-tetrahydropterin synthase deficiency (PTS deficiency) or hyperphenylalaninemia tetrahydrobiopterin-deficient due to PTS deficiency. HPABH4A is an autosomal recessive disorder characterized by depletion of the neurotransmitters dopamine and serotonin, and clinically by severe neurological symptoms unresponsive to the classic phenylalanine-low diet.

  • Ashida A, et al. (1994) A missense mutation (A to G) of 6-pyruvoyltetrahydropterin synthase in tetrahydrobiopterin-deficient form of hyperphenylalaninemia. Genomics. 24:408-10.
  • Ashida A, et al. (1993) cDNA cloning, expression in Escherichia coli and purification of human 6-pyruvoyl-tetrahydropterin synthase. Biochem. Biophys Res Commun. 195:1386-93.
  • Thoeny B, et al. (1992) Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem Biophys Res Commun. 189:1437-43.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items