Quick Order

Human LYVE-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LYVE1cDNA Clone Product Information
Gene_bank_ref_id:NM_006691.3
cDNA Size:969
cDNA Description:ORF Clone of Homo sapiens lymphatic vessel endothelial hyaluronan receptor 1 DNA.
Gene Synonym:HAR, XLKD1, LYVE-1, CRSBP-1
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

LYVE1, also known as LYVE-1, is a type I integral membrane glycoprotein. It contains 1 Link domain and mainly expressed in endothelial cells lining lymphatic vessels. LYVE1 acts as a receptor and binds to both soluble and immobilized hyaluronan. It may function in lymphatic hyaluronan transport and have a role in tumor metastasis. LYVE1 also is a cell surface receptor on lymphatic endothelial cells that can be used as a lymphatic endothelial cell marker, and sort these cells for experimental purposes. It also functions as a ligand-specific transporter trafficking between intracellular organelles and the plasma membrane. It plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding. It may act as an hyaluronan transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.

References
  • Jackson DG. (2003) The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med. 13(1):1-7.
  • Banerji S, et al. (1999) LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol. 144(4):789-801.
  • Mouta Carreira C, et al. (2001) LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis. Cancer Res. 61(22): 8079-84.
  • Cursiefen C, et al. (2002) Lymphatic vessels in vascularized human corneas: immunohistochemical investigation using LYVE-1 and podoplanin. Invest Ophthalmol Vis Sci. 43(7):2127-35.
  • Size / Price
    Catalog:HG10237-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"