Quick Order

Text Size:AAA

Human EPO Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPOcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:582
cDNA Description:ORF Clone of Homo sapiens erythropoietin DNA.
Gene Synonym:EPO, EP, MGC138142
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human EPO Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.

References
  • Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.
  • Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.
  • Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.
  • Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.
  • Size / Price
    Catalog:HG10236-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"