After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MAPK13 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPK13cDNA Clone Product Information
cDNA Size:1101
cDNA Description:ORF Clone of Mus musculus mitogen-activated protein kinase 13 DNA.
Gene Synonym:SAPK4, Serk4, Mapk13
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items