After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse HIST3H2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIST3H2AcDNA Clone Product Information
cDNA Size:393
cDNA Description:ORF Clone of Mus musculus histone cluster 3, H2a DNA.
Gene Synonym:Hist3h2a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse HIST3H2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items