After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TFPI2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
TFPI2cDNA Clone Product Information
Gene Bank Ref.ID:NM_009364.3
cDNA Size:693
cDNA Description:ORF Clone of Mus musculus tissue factor pathway inhibitor 2 DNA.
Gene Synonym:AV000670, PP5/TFPI-2, Tfpi2
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Tissue factor pathway inhibitor-2 (TFPI2), a member of the Kunitz-type serine proteinase inhibitor family, is a structural homologue of tissue factor pathway inhibitor (TFPI). It is a 32 kDa matrix-associated glycoprotein consisting of a short amino-terminal region, three tandem Kunitz-type domains and a positively charged carboxy-terminal tail. TFPI2 inhibits plasmin-dependent activation of several metalloproteinases. TFPI2 is highly abundant in the full-term placenta and widely expressed in various adult human tissues, such as the liver, skeletal muscle, heart, kidney, and pancreas. The expression of TFPI2 in tumors is inversely related to an increasing degree of malignancy, which may suggest a role for TFPI2 in the maintenance of tumor stability and inhibition of the growth of neoplasms. TFPI2 inhibits the tissue factor/factor VIIa (TF/VIIa) complex and a wide variety of serine proteinases including plasmin, plasma kallikrein, factor XIa, trypsin, and chymotrypsin. TFPI2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. TFPI2 has also been shown to induce apoptosis and inhibit angiogenesis, which may contribute significantly to tumor growth inhibition.

  • Peerschke EI, et al. (2004) Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation. Thromb Haemost. 92(4): 811-9.
  • Rollin J, et al. (2005) Expression and methylation status of tissue factor pathway inhibitor-2 gene in non-small-cell lung cancer. Br J Cancer. 92(4): 775-83.
  • Chand HS, et al. (2005) Structure, function and biology of tissue factor pathway inhibitor-2. Thromb Haemost. 94(6): 1122-30.
  • Sierko E, et al. (2007) The role of tissue factor pathway inhibitor-2 in cancer biology. Semin Thromb Hemost. 33(7): 653-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks