After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse FAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FAPcDNA Clone Product Information
cDNA Size:2286
cDNA Description:ORF Clone of Mus musculus fibroblast activation protein DNA.
Gene Synonym:Fap
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

  • Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.
  • Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.
  • Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.
  • O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items