Quick Order

Text Size:AAA

Mouse DPP10 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DPP10 cDNA Clone Product Information
Gene_bank_ref_id:NM_199021.3
RefSeq ORF Size:2403bp
cDNA Description:Full length Clone DNA of Mus musculus dipeptidylpeptidase 10 with C terminal Myc tag.
Gene Synonym:DPPX, Dprp3, 6430601K09Rik, Dpp10
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Inactive dipeptidyl peptidase 10, also known as Dipeptidyl peptidase IV-related protein 3, Dipeptidyl peptidase X, Dipeptidyl peptidase-like protein 2, DPRP-3, DPL2 and DPP10, is a single-pass type I I membrane protein which belongs to the peptidase S9B family. DPPIV subfamily. It may modulate cell surface expression and activity of the potassium channels KCND1 and KCND2. DPP10 / DPRP3 has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Genetic variations in DPP10 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi.

References
  • Nagase T., et al., 2000, DNA Res. 7:143-150.
  • Allen M., et al., 2003, Nat. Genet. 35:258-263.
  • Qi SY, et al.,2003, Biochem J 373 (Pt 1): 179-89. 
  • Chen T., et al., 2003, Adv. Exp. Med. Biol. 524:79-86.
  • Zagha E., et al., 2005, J. Biol. Chem. 280:18853-61.
  • Size / Price
    Catalog: MG50987-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"