Quick Order

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSF3R cDNA Clone Product Information
NCBI RefSeq:NM_000760.2
RefSeq ORF Size:2511bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with N terminal HA tag.
Gene Synonym:CSF3R, CD114, GCSFR
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, N-HA tag on other vectors
Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)
Background

Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is a cell surface receptor for colony stimulating factor 3 (CSF3). It is a critical regulator of granulopoiesis. This type I membrane protein has a composite structure consisting of an immunoglobulin(Ig)-like domain, a cytokine receptor-homologous (CRH) domain and three fibronectin type III (FNIII) domains in the extracellular region. Mutations in the G-CSF receptor leading to carboxy-terminal truncation transduce hyperproliferative growth responses, and are implicated in the pathological progression of severe congenital neutropenia (SCN) to acute myelogenous leukemia (AML). Additionally, autocrine/paracrine stimulation of G-CSFR may be important in the biology of solid tumors, including metastasis.

References
  • Kasper B, et al. (1999) Association of src-kinase Lyn and non-src-kinase Syk with the granulocyte colony-stimulating factor receptor (G-CSFR) is not abrogated in neutrophils from severe congenital neutropenia patients with point mutations in the G-CSFR mRNA. Int J Hematol. 70(4): 241-7.
  • Hollenstein U, et al. (2000) Endotoxin down-modulates granulocyte colony-stimulating factor receptor (CD114) on human neutrophils. J Infect Dis. 182(1): 343-6.
  • Kindwall-Keller TL, et al. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine. 43(2): 114-23.
  • Beel K, et al. (2009) G-CSF receptor (CSF3R) mutations in X-linked neutropenia evolving to acute myeloid leukemia or myelodysplasia. Haematologica. 94(10): 1449-52.
  •  

    G-CSFR/CD114 related areas, pathways, and other information

    Size / Price
    Catalog: HG10218-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"