Quick Order

Human LRG1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRG1 cDNA Clone Product Information
Gene_bank_ref_id:BC034389
RefSeq ORF Size:1044bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine-rich alpha-2-glycoprotein 1 with N terminal His tag.
Gene Synonym:LRG, HMFT1766, LRG1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

LRG1 belongs to the leucine-rich repeat (LRR) family. Members of this family are involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation. It contains 4 LIM zinc-binding domains and 1 Rho-GAP domain.

References
  • O Donnell LC. et al., 2002, J Leukoc Biol. 72 (3): 478-85.
  • Li X. et al., 2007, Neurosci Lett. 413 (2): 141-4.
  • Ramachandran P. et al., 2006, J Proteome Res. 5 (6): 1493-503.
  • Size / Price
    Catalog: HG13371-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"