Quick Order

Human GFRA3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFRA3cDNA Clone Product Information
cDNA Size:1203
cDNA Description:ORF Clone of Homo sapiens GDNF family receptor alpha 3 DNA.
Gene Synonym:GFRA3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Glial cell line-Derived Neurotrophic Factor (GDNF) Related Products
Product nameProduct name

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 3 (GFRA3) or GDNFRa3 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA3 / GDNFRa3 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. The neurotrophic growth factor artemin binds selectively to GDNF family receptor α3 (GFRA3 / GDNFRa3), forming a molecular complex with the co-receptor RET which mediates downstream signaling. This signaling pathway has been demonstrated to play an important role in the survival and maintenance of nociceptive sensory neurons and in the development of sympathetic neurons.

  • Widenfalk J, et al. (2000) Neurturin, RET, GFRalpha-1 and GFRalpha-2, but not GFRalpha-3, mRNA are expressed in mice gonads. Cell Tissue Res. 299(3): 409-15.
  • Li J, et al. (2009) Autocrine regulation of early embryonic development by the artemin-GFRA3 (GDNF family receptor-alpha 3) signaling system in mice. FEBS Lett. 583(15): 2479-85.
  • Yang C, et al. (2006) Distribution of GDNF family receptor alpha3 and RET in rat and human non-neural tissues. J Mol Histol. 37(1-2): 69-77.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items