Quick Order

Mouse KLK-8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK8cDNA Clone Product Information
Gene_bank_ref_id:NM_008940.2
cDNA Size:783
cDNA Description:ORF Clone of Mus musculus kallikrein related-peptidase 8 DNA.
Gene Synonym:BSP1, Nrpn, Prss19, Klk8
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Kallikrein-8, also known as Neuropsin, Serine protease 19, Serine protease TADG-14, Tumor-associated differentially expressed gene 14 protein and KLK8, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. It is a serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Kallikrein-8 / KLK8 plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway. It regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. It is involved in skin desquamation and keratinocyte proliferation and plays a role in the secondary phase of pathogenesis following spinal cord injury. It also cleaves L1CAM in response to increased neural activity. It induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Kallikrein-8 / KLK8 is expressed at high levels in serum, ascites fluid and tumor cytosol of advanced stage ovarian cancer patients and may serve as a marker of ovarian cancer. Kallikrein-8 / KLK8 may have potential clinical value for disease diagnosis or prognosis and it may also be a useful therapeutic target.

Size / Price
Catalog:MG50967-CM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"