After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse B2M Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B2McDNA Clone Product Information
Gene_bank_ref_id:NM_009735.3
cDNA Size:360
cDNA Description:ORF Clone of Mus musculus beta-2 microglobulin DNA.
Gene Synonym:Ly-m11, beta2m, beta2-m, B2m
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found expression in all nucleated cells (excludes red blood cells). The major function of MHC class I moleculesis is to display fragments of proteins from within the cell to T-cells and cells containing foreign proteins will be attacked. B2M(β2-Microglobulin) is a low molecular weight protein. It was demonstrated that B2M(β2-Microglobulin) was localized in the membranes of nucleated cells and was found to be associated with HL-A antigens.B2M(β2- Microglobulin) is present in free form in various body fluids and as a subunit of histocompatibility antigens on cell surfaces lateral to theα3 chain. Unlikeα3, β2 has no transmembrane region. Directly above β2 lies the α1 chain, which itself is lateral to the α2. In the absence of B2M(β2 microglobulin), very limited amounts of MHC class I (classical and non-classical) molecules can be detected on the surface. In the absence of MHC class I, CD8 T cells, a subset of T cells involved in the development of acquired immunity cannot develop. Low levels of B2M(β2 microglobulin) can indicate non-progression of HIV.

References
  • Poulik MD, et al. (1979) Beta 2-Microglobulin: methods and clinical applications. CRC Ctit Rev Clin Lab Sci. 10(3): 225-45.
  • Poulik MD, et al. (1975) Beta2-Microglobulins. Contemp Top Mol Immunol. 4: 157-204.
  • Berggard I. (1976) Beta2-Microglobulins: isolation, properties, and distribution. Fed Proc. 35(5): 1167-70.
  • Size / Price
    Catalog:MG50957-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"