After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BNIPL ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BNIPL cDNA Clone Product Information
Gene_bank_ref_id:BC027868.1
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2/adenovirus E1B 19kD interacting protein like with C terminal HA tag.
Gene Synonym:PP753, BNIP-S, BNIPL-1, BNIPL-2, BNIPL
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

BNIP-2- like (BNIPL), also known as Bcl-2/adenovirus E1B 19 kDa interacting protein 2-like, is a apaptosis-associated protein that shares 72% homology with BNIP-2. BNIPL is highly expressed in human placenta and lung. There are two alternative splices: BNIPL-1 and BNIPL-2. Both BNIPL-1 and BNIPL-2 have a conserved arginine-patch motif in Rho protein family. BNIPL-1 has function in suppressing cell growth through binding to MIF (macrophage migration inhibitory factor) and GFER (growth factor erv1(saccharomyces cerevisiae)-like). BNIPL-2 may suppress the Cdc42GAP’s activity through ineracting with Cdc42GAP. BNIPL-2, containg a key BCH domain, which may induce the cell pseudopod growth, takes part in modulating cell migrations. Thus it suggested BNIPL-2 implicated in cell migration progresses and tumor translocation.

References
  • Shen L, et al. (2003) The apoptosis-associated protein BNIPL interacts with two cell proliferation-related proteins, MIF and GFER. FEBS. 540(1-3): 86-90.
  • Qin WX, et al. (2003) BNIPL-2, a novel homologue of BNIP-2, interacts with Bcl-2 and Cdc42GAP in apoptosis. Biochemical and Biophysical Research Communications. 308(2): 379-85.
  • Yasuda M, et al. (1999) BNIP3 alpha: a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res. 59 (3): 533-7.
  • Size / Price
    Catalog: HG11460-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"