Quick Order

Text Size:AAA

Mouse SPINK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPINK4cDNA Clone Product Information
cDNA Size:261
cDNA Description:ORF Clone of Mus musculus serine peptidase inhibitor, Kazal type 4 DNA.
Gene Synonym:MPGC60, Spink4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Serine protease inhibitor Kazal-type 4, also known as Peptide PEC-60 homolog and SPINK4, is a secreted protein which contains one Kazal-like domain. SPINK4 is a member of the SPINK protein family. The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). SPINK1 plays an important role in protecting the pancreas against excessive trypsinogen activation. It is a potent natural inhibitor of pancreatic trypsin activity. SPINK1 mutations are associated with the development of acute and chronic pancreatitis and have been detected in all forms of chronic pancreatitis. SPINK2 functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. SPINK9 was identified in human skin. Its expression was strong in palmar epidermis, but not detectable or very low in non palmoplantar skin.

  • Schneider, A. et al., 2004,Gastroenterol Clin North Am. 33 (4): 789-806.
  • Wapenaar, MC. et al., 2007, Immunogenetics. 59 (5): 349-57.
  • Brattsand, M. et al., 2009, J Invest Dermatol. 129 (7): 1656-65.
  • Chen, T. et al., 2009, Proteins. 77 (1): 209-19.
  • Noah, TK. et al., 2010, Exp Cell Res. 316 (3): 452-65.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items