Quick Order

Human NAA10 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NAA10 cDNA Clone Product Information
Gene_bank_ref_id:BC000308
RefSeq ORF Size:708bp
cDNA Description:Full length Clone DNA of Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit with C terminal His tag.
Gene Synonym:TE2, ARD1, NATD, ARD1A, DXS707
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ARD1 is a member of the 20-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 403-574), and a 46-kDa N-terminal domain (amino acids 1-402). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G0. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-110) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.

Size / Price
Catalog: HG14293-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"