After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CNPY4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNPY4cDNA Clone Product Information
cDNA Size:747
cDNA Description:ORF Clone of Homo sapiens canopy 4 homolog (zebrafish) DNA.
Gene Synonym:PRAT4B, CNPY4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.

  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items