After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A2cDNA Clone Product Information
cDNA Size:294
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A2 DNA.
Gene Synonym:S100A2, CAN19, S100L, MGC111539
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10180-ACG$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10180-ACR$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10180-ANG$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10180-ANR$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10180-CF$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10180-CH$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10180-CM$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10180-CY$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone)HG10180-M$95
Human S100A2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10180-M-F$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10180-M-N$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10180-NF$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10180-NH$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10180-NM$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10180-NY$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10180-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.

  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks