After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNTN4cDNA Clone Product Information
cDNA Size:3081
cDNA Description:ORF Clone of Homo sapiens contactin 4, transcript variant 1 DNA.
Gene Synonym:CNTN4, AXCAM, BIG-2, SCA16, CNTN4A, MGC33615
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10178-ACG$425
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10178-ACR$425
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10178-CF$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10178-CH$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10178-CM$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10178-CY$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10178-M$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10178-M-N$645
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10178-NF$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10178-NH$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10178-NM$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10178-NY$395
Human CNTN4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10178-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name

Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high expression in testes, thyroid, small intestine, uterus and brain. This protein is an neuronal membrane protein that functions as an glycosylphosphatidylinositol- anchored cell adhesion molecule. Contactin-4 is considered as a candidate protein responsible for the differentiation potential of human neuroblastoma cells and it has been implicated in some cases of autism and spinocerebellar ataxia type 16. Studies of the cantactin family have revealed a complex pattern of hemophilic and heterophilic interactions that are required for axon growth and pathfinding. Such studies demonstrate that these essential functions are mediated by the combination and juxtaposition of multiple Ig and FNIII domains. Second, these neuronal adhesion molecules demonstrate highly regulated temporal and spatial expression patterns in the CNS. For this reason, the disruption of the regulatory region of the predominant brain-expressed isoform reasonable would be expected to have significant functional consequences. 

  • Zeng L, et al. (2002) A novel splice variant of the cell adhesion molecule contactin 4 ( CNTN4) is mainly expressed in human brain. J Hum Genet. 47 (9): 497-9.
  • Thomas Fernandez, et al. (2004) Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome. Am J Hum Genet. 74 (6): 1286-93.
  • Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items