After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse GFRA3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFRA3cDNA Clone Product Information
cDNA Size:1194
cDNA Description:ORF Clone of Mus musculus glial cell line derived neurotrophic factor family receptor alpha 3 DNA.
Gene Synonym:Y15110, Gfra3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Glial cell line-Derived Neurotrophic Factor (GDNF) Related Products
Product nameProduct name

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 3 (GFRA3) or GDNFRa3 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA3 / GDNFRa3 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. The neurotrophic growth factor artemin binds selectively to GDNF family receptor α3 (GFRA3 / GDNFRa3), forming a molecular complex with the co-receptor RET which mediates downstream signaling. This signaling pathway has been demonstrated to play an important role in the survival and maintenance of nociceptive sensory neurons and in the development of sympathetic neurons.

  • Widenfalk J, et al. (2000) Neurturin, RET, GFRalpha-1 and GFRalpha-2, but not GFRalpha-3, mRNA are expressed in mice gonads. Cell Tissue Res. 299(3): 409-15.
  • Li J, et al. (2009) Autocrine regulation of early embryonic development by the artemin-GFRA3 (GDNF family receptor-alpha 3) signaling system in mice. FEBS Lett. 583(15): 2479-85.
  • Yang C, et al. (2006) Distribution of GDNF family receptor alpha3 and RET in rat and human non-neural tissues. J Mol Histol. 37(1-2): 69-77.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items