Quick Order

Text Size:AAA

Human ING4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ING4 cDNA Clone Product Information
Gene_bank_ref_id:BC007781
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 4 with C terminal His tag.
Gene Synonym:My036, MGC12557, my036, p29ING4, ING4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ING4 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. ING4 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. ING4 protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. ING4 is a component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Through chromatin acetylation it may function in DNA replication. ING4 may also inhibit tumor progression by modulating the transcriptional output of signaling pathways which regulate cell proliferation.

References
  • Shiseki M. et al., 2003, Cancer Res. 63 (10): 2373-8.
  • Garkavtsev. et al., 2004, Nature. 428 (6980): 328-32.
  • Tsai. et al., 2008, Exp Cell Res. 314 (17): 3130-41.
  • Size / Price
    Catalog: HG14264-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"