Quick Order

Text Size:AAA

Human PMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PMP2cDNA Clone Product Information
Gene_bank_ref_id:NM_002677.3
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens peripheral myelin protein 2 DNA.
Gene Synonym:P2, MP2, FABP8, M-FABP, PMP2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

Myelin P2 protein, also known as PMP2, is a cytosolic protein found primarily in peripheral nerves. It Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family. PMP2 is a small, basic, and cytoplasmic lipid binding protein of peripheral myelin. It is similar in amino acid sequence and tertiary structure to fatty acid binding proteins found in the liver, adipocytes, and intestine, its expression is limited to the nervous system. PMP2 is detected only in myelin-producing cells of the central and peripheral nervous systems, the oligodendrocytes and Schwann cells, respectively. PMP2 may play a role in lipid transport protein in Schwann cells. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior.

References
  • Hayasaka, K. et al., 1993, Genomics. 18 (2): 244-8.
  • Polverini, E. et al., 2006, J Struct Biol. 153 (3): 253-63.
  • Gould,R.M. et al., 2008, Neuron Glia Biol. 4 (2):137-52.
  • Size / Price
    Catalog:HG11426-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"