Quick Order

Human ICAM4 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICAM4 cDNA Clone Product Information
Gene_bank_ref_id:BC000046
RefSeq ORF Size:819bp
cDNA Description:Full length Clone DNA of Homo sapiens ?intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)? with N terminal His tag.
Gene Synonym:LW, CD242, ICAM4
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ICAM4, also known as CD242, is a member of the?immunoglobulin superfamily, ICAM family. ICAM4 contains 2?Ig-like C2-type (immunoglobulin-like) domains. It is similar to the intercellular adhesion molecule (ICAM) protein family. ICAM4 binds to the leukocyte adhesion LFA-1 protein. ICAM4's first reported receptors were CD11a/CD18 and CD11b/CD18. ICAM4 functions as a ligand for the monocyte/macrophage-specific CD11c/CD18. Deletion of the individual immunoglobulin domains of ICAM4 demonstrated that both its domains contain binding sites for CD11c/CD18. CD11c/CD18 is expressed on macrophages in spleen and bone marrow. Inhibition of erythrophagocytosis by anti-ICAM4 and anti-integrin antibodies suggests a role for these interactions in removal of senescent red cells.

References
  • Gorst DW. et al., 1980, Vox Sanguinis. 38 (2): 99-105.
  • Vos GH. et al., 1973, Blood. 42 (3): 445-53.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Daniels G. et al., 2002, Transfusion Medicine. 12 (5): 287-95.
  • Size / Price
    Catalog: HG13327-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"