After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human tPAβ DNA transcript variant 1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLAT cDNA Clone Product Information
Gene_bank_ref_id:NM_000930.3
RefSeq ORF Size:1689bp
cDNA Description:Full length Clone DNA of Homo sapiens plasminogen activator, tissue (PLAT), transcript variant 1 with N terminal HA tag.
Gene Synonym:PLAT, TPA, T-PA, DKFZp686I03148
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Tissue plasminogen activator (abbreviated tPA or PLAT), is traditionally viewed as a simple serine protease whose main function is to convert plasminogen into biologically active plasmin. As a protease, tPA plays a crucial role in regulating blood fibrinolysis, in maintaining the homeostasis of extracellular matrix and in modulating the post-translational activation of growth factors. tPA is synthesized and secreted as a single chain polypeptide precursor which is cleaved in turn by plasmin. Proteolytic cleavage at the C-terminal side of Arg275 generates the enzyme composed of two subunits, designated as α and β chains which are held together by a single disulfide bond. Unlike the other members of the chymotrypsin family, tPA has one particular distinction in that the catalytic efficiency of the single-chain enzyme is only slightly lower than that of the proteolytically cleaved form and is therefore not a true zymogen. tPA is found not only in the blood, where its primary function is as a thrombolytic enzyme, but also in the central nervous system (CNS). It participats in a number of physiological and pathological events in the CNS, as well as the role of neuroserpin as the natural regulator of tPA's activity in these processes. Increased or decreased activity of tPA leads to hyperfibrinolysis or hypofibrinolysis, respectively. In addition, as a cytokine, tPA plays a pivotal role in the pathogenesis of renal interstitial fibrosis through diverse mechanisms. Thus, as a fibrogenic cytokine, it promotes the progression of kidney diseases.

References
  • Yepes M, et al. (2004) New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp Biol Med (Maywood). 229(11): 1097-104.
  • Samson AL, et al. (2006) Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron. 50(5): 673-8.
  • Skrzypiec AE, et al. (2008) Tissue plasminogen activator in the amygdala: a new role for an old protease. J Physiol Pharmacol. 59 Suppl 8: 135-46.
  • Hu K, et al. (2008) Novel actions of tissue-type plasminogen activator in chronic kidney disease. Front Biosci. 13: 5174-86.
  • Size / Price
    Catalog: HG10157-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"