Quick Order

Text Size:AAA

Human B3GNT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B3GNT2cDNA Clone Product Information
Gene_bank_ref_id:NM_006577.5
cDNA Size:1194
cDNA Description:ORF Clone of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 DNA.
Gene Synonym:B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein which prefers the substrate of lacto-N-neotetraose. Alternative splicing produced 2 isoforms of the human protein. B3GNT2 catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Enzymatic activities of some glycosyltransferases are markedly increased via complex formation with other transferases or cofactor proteins. B3GNT2 and beta3Gn-T8 can form a heterodimer in vitro and that the complex exhibits much higher enzymatic activity than either enzyme alone. It is found that up-regulation of beta3Gn-T8 in differentiated HL-60 cells may increases poly-N-acetyllactosamine chains by activating intrinsic B3GNT2.

References
  • Australo-An, et al. (2010) Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet. 42(2):123-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Seko A, et al. (2008) Activation of beta1,3-N-acetylglucosaminyltransferase-2 (beta3Gn-T2) by beta3Gn-T8. Possible involvement of beta3Gn-T8 in increasing poly-N-acetyllactosamine chains in differentiated HL-60 cells. J Biol Chem. 283(48):33094-100.
  • Size / Price
    Catalog:HG11416-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"